Obstet Gynecol Sci Search

CLOSE


Obstet Gynecol Sci > Volume 68(5); 2025 > Article
Ju, Hou, Wang, Zhang, and Feng: Correlation of VEGF, HIF-1α, and MMP2 expression in placental villi among patients with recurrent spontaneous abortion

Abstract

Objective

In this study, the expression and clinical significance of vascular endothelial growth factor (VEGF), hypoxia inducible factor-1α (HIF-1α), and matrix metalloproteinase-2 (MMP2) in the placental villi of patients experiencing recurrent spontaneous abortion were investigated.

Methods

Fifty-one patients with recurrent spontaneous abortion (RSA) and 50 control individuals were enrolled (between January 2022 and December 2023). The messenger RNA (mRNA) and protein levels of VEGF, HIF-1α, and MMP2 in the placental villi of all enrolled patients were assessed using quantitative real-time polymerase chain reaction and western blot techniques. Additionally, the correlation between VEGF, HIF-1α, and MMP2 expression was analyzed using Pearson correlation coefficient.

Results

The results revealed that the levels of VEGF mRNA and protein in the placental villi of patients with RSA were significantly lower than those in the control group, and this difference was statistically significant. Conversely, the mRNA and protein levels of HIF-1α and MMP2 were significantly higher in the RSA patient group than in the control group. Furthermore, the study revealed a negative correlation between the expression of VEGF and MMP2 in the placental villi of patients with RSA, and a positive correlation was observed between the expression of HIF-1α and MMP2.

Conclusion

The downregulated expression of VEGF and upregulated expression of HIF-1α and MMP2 in the placental villi of patients with RSA may contribute to the pathogenesis of RSA. However, further investigation is required to elucidate the specific molecular regulatory mechanisms.

Introduction

Recurrent spontaneous abortion (RSA), defined as two or more consecutive spontaneous abortions with the same sexual partner, is a prevalent complication of pregnancy, with its incidence escalating with increased frequency. Recurrent abortion is characterized by an intricate and diverse etiology, encompassing established factors such as chromosomal abnormalities, autoimmunity, anatomical anomalies, endocrine elements, and infections [1,2]. According to previous studies, the expression of KISS-1 in patients with spontaneous abortion decreases significantly; notably, KISS-1 plays an important role in pregnancy implantation and continuation [3]. However, a subset of patients experiencing recurrent miscarriage exhibit an unknown etiology. Several studies reveal a significant association between recurrent miscarriage and impaired blood vessel formation in the placental tissue [4,5]. Notably, vascular endothelial growth factor (VEGF) plays a pivotal role in promoting angiogenesis, exerting a positive influence on vascular remodeling during early pregnancy stages [6,7].
VEGF is involved in oocyte maturation, trophoblast cell proliferation, embryo implantation and development, placental angiogenesis, and maternal and fetal vessel growth in utero. Its absence or downregulation can cause vascular network aberrations in chorionic villi or anomalies in cell infiltration and differentiation, culminating in miscarriage [8]. Conversely, hypoxia-inducible factor-1α (HIF-1α) regulates trophoblast differentiation in response to oxygen tension, thereby influencing embryonic growth and development during early pregnancy [9,10]. Its expression primarily impacts energy metabolism, functional activity of trophectoderm cells, and embryonic vasculature formation in a hypoxic environment.
Matrix metalloproteinases (MMPs) are peptide chain endonucleases containing Zn2+, which are involved in extracellular matrix (ECM) degradation. Increased MMP expression in the recurrent miscarriage metaphase suggests that they may contribute to recurrent miscarriage via intercellular matrix degradation [11].
The significance of VEGF, HIF-1α, and MMPs in recurrent miscarriage has been reported in past studies; however, the correlation between their expression in the placental villous tissue remains unclear. To enhance the prevention and treatment of recurrent miscarriages, fundamental indicators should be measured and their fluctuations elucidated. Therefore, in this study, the correlations between VEGF, HIF-1α, and MMP2 expression in the placental villous tissue of patients who have experienced RSAs were analyzed, providing a clinical reference for the management and treatment of such patients.

Materials and methods

1. General information

Fifty-one patients with recurrent miscarriage who attended the Fourth Hospital of Shijiazhuang between January 2022 and December 2023 were selected for this study (RSA group). Their age ranged from 23-43 years, with a mean age of 29.78±4.02 years. The gestation period varied from 56-73 days, with a mean of 61.78±3.05 days. The inclusion criteria were adherent to the diagnostic standards outlined in the expert consensus on the diagnosis and management of recurrent miscarriage: 1) history of three or more spontaneous miscarriages; 2) gestation period of 6-12 weeks; 3) no history of cardiovascular, endocrine, or immune system diseases; 4) clinical symptoms indicating a history of amenorrhea with little or no vaginal bleeding; and 5) ultrasound suggesting intrauterine pregnancy without germ or cardiac tube pulsation. Fifty cases of voluntary early pregnancy termination within the same timeframe were selected as the control group. These participants ranged in age from 20-38 years, with a mean age of 28.68±3.13 years. The gestation period ranged from 55-74 days, with an average of 60.88±2.41 days. The inclusion criteria were: 1) gestation period of ≤12 weeks; 2) ultrasound showing normal embryonic development with visible embryo and fetal heartbeat; 3) no previous history of abortion; and 4) no cardiovascular, endocrine, or immune system disorders, or other pregnancy complications.
Sample size assessment is the estimation of the minimum number of observed cases required for a clinical trial to ensure that the conclusion of a particular clinical trial is scientific, accurate, and reliable. In this study, the minimum sample size required was calculated to satisfy statistical precision and reliability (controlling class I errors and ensuring inspection efficiency). It was found that each group must include at least 50 individuals. The study was approved by the Ethics Committee of the Fourth Hospital of Shijiazhuang (approval no: 20210002), and clinical specimens were collected in accordance with the Declaration of Helsinki of the World Medical Association. Informed consent and signed confirmation were obtained from the patients and their families.

2. Main reagents and instruments

The total tissue RNA extraction kit (CoWin Biotech Co., Beijin, China) was obtained from Beijing Kangwei Century Biotechnology Company (CoWin Biotech Co.). The polymerase chain reaction (PCR) reverse transcription into cDNA (PrimeScriptTM RT Reagent kit; Takara Bio Inc., Shiga, Japan) and PCR amplification kits (SYBR® Premix Ex TaqTM II; Takara Bio Inc.) were purchased from TaKaRa (Takara Bio Inc.). Additionally, the bicinchoninic assay (BCA) protein concentration assay kit (Beyotime Biotech Inc., Shanghai, China) was procured from Shanghai Biyuntian Biotechnology Company. The electrochemiluminescence color development kit was acquired from Invitrogen (Invitrogen, Carlsbad, CA, USA). Rabbit anti-VEGF polyclonal antibody (Abcam, ab2350), rabbit anti-HIF-1α polyclonal antibody (Abcam, ab228649), rabbit anti-MMP2 polyclonal antibody (Abcam, ab97779), and sheep anti-rabbit immunoglobulin G-horse radish peroxidase (HRP) secondary antibody (Cell Signaling Technology Inc., Danvers, MA, USA; cat: #7054) were utilized. Laboratory instruments such as electrophoresis tank and electrotransformer were obtained from Bio-Rad (Bio-Rad Laboratories Inc., Hercules, CA, USA). The ChemiDoc XRS chemically enhanced luminescence detection system (Bio-Rad Laboratories Inc.) and Gel-Doc gel imaging analysis system (Bio-Rad Laboratories Inc.) were used. The Image J image processing software (National Institutes of Health, Bethesda, MD, USA) was used for image analysis.

3. Hematoxylin and eosin (HE) staining

Placental villous tissues were washed with normal saline to remove blood, fixed with 4% paraformaldehyde for 48 hours, dehydrated with gradient alcohol, embedded in paraffin, and then cut into 4-mm thick slices. The sections were dewaxed in xylene and gradient alcohol, stained with hematoxylin for 5 minutes, and then immersed in hydrochloric acid for a few seconds. Following eosin staining for 2 minutes, the staining effect was observed under the microscope. Finally, xylene penetration and resin sealing were performed. All sections were observed under a microscope.

4. Sample collection and storage

Placental villous tissues were collected from both groups after abortion, rinsed with saline to remove all blood cells, and stored in freezing tubes at −80°C for subsequent total RNA and protein extraction.

5. Quantitative real-time polymerase chain reaction (qRT-PCR)

Placental villous tissue specimens were cryogenically ground, and subsequently, total RNA extraction was executed using a designated RNA extraction kit (CoWin Biotech Co.). The optical density (OD) 260/280 ratio was assessed to ascertain the content, integrity, and purity of the RNA. Subsequently, cDNA was synthesized from the extracted RNA serving as a template for the subsequent qRT-PCR reaction using a PCR reverse transcription kit (Takara Bio Inc.). The qPCR procedure followed the manufacturer’s protocol for the SYBR Green Master Mix (Takara Bio Inc.). The reaction system comprised a final volume of 20 μL, incorporating 10 μL SYBR Premix Ex Taq II (Tli RNaseH Plus; Takara Bio Inc.), 2 μL cDNA, 0.8 μL each of upstream and downstream primers, and 6.4 μL nucleasefree water. The primer sequences are presented in Table 1. The PCR reaction conditions included pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 30 seonds, annealing at 60°C for 1 minute, extension at 72°C for 15 seonds, all repeated for 40 cycles. Utilizing the glyceraldehyde 3-phosphate dehydrogenase gene as an internal reference, the target mRNA expression levels in the samples were calculated utilizing the 2−ΔΔCT method. All procedures were strictly adherent to the provided kit instructions, with PCR experiments being repeated thrice.

6. Western blotting

The Trizol kit (Invitrogen, Carlsbad, CA, USA) was used to extract total protein from the villous tissue. The total protein was quantified using the BCA method. Subsequently, the protein samples were standardized based on their measured content to ensure uniform protein quantities in equivalent sample volumes, thereby maintaining consistency. Then, the protein samples were subjected to sodium dodecyl-sulfate polyacrylamide gel electrophoresis gel electrophoresis, polyvinylidene fluoride (PVDF) membrane transfer, and subsequent closure with Tris-buffered saline containing 0.5% (v/v) tween 20 solution containing 5% skimmed milk powder at room temperature for 2 hours. The PVDF membranes were later subjected to overnight incubation at 4°C in a primary antibody solution (dilution 1:500). On the subsequent day, the membrane was removed, the primary antibody was discarded, and the PVDF membrane was subjected to three 10-minute washes. It was then immersed in an incubation solution with HRP-labelled secondary antibody (dilution 1:50,000) and incubated at 37°C for 2 hours. After discarding the secondary antibody, the membrane was washed thrice for 10 minutes each time. Semi-quantitative analysis of the expressed bands was performed using the Image J medical image analysis software (National Institutes of Health), with the results expressed as mean optical density values OD values. The ratio of the OD of the target factor to the OD of the internal reference (β-actin) was employed to interpret the acquired data.

7. Statistical analysis

Statistical analysis was conducted using the SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Data were presented as the mean±standard deviation and analyzed using the t-test. The correlation between VEGF, HIF-1α, and MMP2 mRNA and protein expression in placental villous tissue was analyzed using Pearson’s method. A P-value of <0.05 was considered statistically significant.

Results

1. Comparison of general information of pregnant women between the two groups

General information such as age (years), gestational duration (days), and body mass index was assessed separately, and the analysis revealed no statistically significant differences between the groups (P>0.05) (Table 2).

2. Pathological morphological changes of placental villi in patients with RSA using HE staining

The histological morphology of placental villi in both cohorts was examined using HE staining. As illustrated in Fig. 1, compared to the control group, the placental villi in the RSA group exhibited variability in size, irregular villous outlines, and an increased presence of interstitial cells within the villi. Additionally, trophoblast cells displayed polarity, and certain villi showed signs of interstitial edema.

3. Comparison of VEGF, HIF-1α, and MMP2 mRNA levels between the placental villous tissues of two groups

Relative to the control group, the mRNA levels of VEGF in the placental villous tissue decreased significantly among patients with RSA (P<0.05). Conversely, the mRNA expression levels of HIF-1α and MMP2 were observed to be relatively high in individuals with a history of RSA (P<0.05) compared to the control group (Table 3, Fig. 2).

4. Comparison of VEGF, HIF-1α, and MMP2 protein levels between in the placental villous tissues of two groups

Compared to the control group, the protein levels of VEGF were significantly reduced in the placental villous tissue of the patients in RSA group (P<0.05), consistent with the mRNA analysis results. Similarly, the protein levels of HIF-1α and MMP2 were significantly elevated in the RSA group patients (P<0.05) compared to those in the control group (Table 4, Fig. 3).

5. Correlation of VEGF, HIF-1α, and MMP2 expression between the placental villous tissues of patients with RSA

Pearson analysis revealed a lack of significant correlation between the mRNA expression of VEGF, HIF-1α, and MMP2 in the placental villi of the patients in the RSA group (Fig. 4A-C). Conversely, the western blot results indicated that the levels of VEGF protein were inversely correlated with those of MMP2 in the placental villous tissue (r=−0.375; R2=0.141; Fig. 4D), while the levels of HIF-1α protein exhibited a positive correlation with MMP2 (r=0.350; R2=0.123; Fig. 4F). Consistent with the mRNA findings, no significant correlation was observed between VEGF and HIF-1α expression at the protein level (Fig. 4E). Detailed results of the correlation analysis are presented in Table 5.

Discussion

RSA is a prevalent complication during pregnancy but the mechanisms involved have not been fully elucidated. Given the challenging clinical treatment and high medical costs involved, it significantly impacts the physical and mental well-being of women and their families. In a normal pregnancy, neovascularization and the proliferation of trophoblast cells occurs within the placental villous tissue [12] with VEGF acting as a specific mitogen and survival factor for endothelial cells to mediate angiogenesis under both physiological and pathological conditions. VEGF stimulates the proliferation and differentiation of vascular endothelial cells but abnormalities in angiogenesis and/or its function may promote the onset of a spontaneous abortion [13,14].
The significant decrease in VEGF mRNA and protein expression in the chorionic and metaphase tissues of patients who experienced an RSA [15] suggests that reduced VEGF expression plays a vital role and is therefore a potential target for drug development. The N6-methyladenosine modulator plays a central role in stromal/immune cell interactions at the maternal/fetal interface, potentially inducing RSA by regulating VEGF-mediated stromal cell-macrophage interactions [16]. This is consistent with our findings indicating that VEGF mRNA and protein expression are significantly lower in the placental villous tissue of patients who had experienced an RSA. However, Pang et al. [16,17] reported that soluble Fms-like tyrosine kinase (sFlt-1) and VEGF protein expression were significantly higher in the serum and chorionic villous tissues of patients with unexplained RSA compared to those who experienced a healthy early pregnancy abortion. Similarly, Xu et al. [18] noted that the activation of the Fas/FasL signaling pathway promotes trophoblast apoptosis through oxidative stress and is associated with inhibition of the NOTCH1 signaling pathway and upregulated sFlt-1 and VEGF expression. Therefore, the present study was designed to explore and compare VEGF expression to that of HIF-1α and MMP2 in the placental villous tissue of patients with RSA.
HIF-1α, as a hypoxia-inducible transcription factor, governs the adaptive transcriptional response to hypoxia via interaction with hypoxia response elements. Research demonstrates that VEGF serves as a target gene of HIF-1α, whereby HIF-1α, particularly in hypoxic conditions, fosters vascular neogenesis by enhancing VEGF expression [19]. A recent study has shown that the expression of HIF1α mRNA increases in placental tissue samples of patients with recurrent miscarriage [20]. Notably, the expression of HIF-1α in the endometrium of patients with RSA was significantly higher than that of normal fertile women and positively correlated with microvascular density (MVD), suggesting that endometrial hypoxia and altered neovascular MVD could contribute to recurrent miscarriage [21]. Our results corroborated these findings, showing that the expression levels of HIF-1α mRNA and protein in the placental villous tissue of patients with RSA were markedly higher than those in the control group, signifying a hypoxic state in the villous tissue of patients with RSA, thus aligning with prior research. Similarly, a study by Liu et al. [22] showed that the levels of HIF-1α mRNA in the chorionic tissue of patients in the missed abortion group were higher than those in the normal pregnancy group, and the levels of VEGF mRNA were lower than those in the normal pregnancy group. Moreover, Pearson correlation analysis showed that the expression of p53 was positively correlated with HIF-1α and negatively correlated with VEGF in the missed abortion group. However, another study showed that VEGF and HIF-1α expression in chorionic villi was significantly higher in patients with ≥4 miscarriages than in patients with ≤3 miscarriages, and Spearman correlation analysis revealed that the expression of miR-29a was positively correlated with VEGF and HIF-1α expression [23]. Our study is consistent with that by Liu et al. [22]; the results show that mRNA and protein levels of VEGF decreased significantly, while HIF-1α was higher in the chorionic tissues of patients than in those of the normal pregnancy group. Interestingly, there was no significant correlation between VEGF and HIF-1α in the chorionic villous tissue of patients in the RSA group; however, this result should be validated and confirmed using a larger sample.
MMPs constitute a class of zinc ion-dependent proteases that actively participate in the degradation and remodeling of the ECM, playing a partial role in angiogenesis. MMPs are associated with invasive diseases and angiogenesis, with MMP2 and MMP9 identified as key enzymes facilitating the invasion of the endometrium by trophoblasts during early pregnancy [24,25]. The balanced expression of MMP2/9 and their inhibitors (tissue inhibitors of matrix [TIMP] 1/2) is necessary to sustain a successful pregnancy [26]. Upregulated MMP2 and MMP9 in the endometrium of women affected by infectious RSA is accompanied by an imbalance of MMPs/TIMPs, implying that infection triggers excessive degradation of the endometrial matrix, leading to miscarriage [27]. Nissi et al. [28] reported a significant increase in the levels of MMP9 and the MMP2/TIMP-2 complex in the serum of patients with RSA. Furthermore, a recent meta-analysis provided evidence of a significant association between the MMP2-735T and MMP9-1562T alleles and the risk of RSA [29]. A case-control study in the Chinese Han population also revealed a significant association between MMP2 and MMP9 polymorphisms in the promoter region and the risk of RSA [30]. The findings of this study were consistent with the aforementioned ones, demonstrating significantly elevated levels of MMP2 mRNA and protein in placental villous tissues of patients with RSA compared to those in the control group. These results informed the hypothesis that MMP2 overexpression induces excessive degradation of the endometrial matrix, consequently inhibiting the invasion and migration of villous tissue, ultimately resulting in recurrent miscarriage. The negative correlation between VEGF and MMP2 expression and the positive correlation between HIF-1α and MMP2 expression suggests the involvement of these elements in the development and progression of RSA but further studies are required to fully elucidate the mechanism.
This study has certain limitations. The relatively small sample size may have limited the reliability and accuracy of the results, thus necessitating larger multicenter studies in the future. Second, RSA is inherently heterogeneous and encompasses a spectrum of etiologies, clinical presentations, and pathophysiological mechanisms. This heterogeneity is evident in its diverse underlying causes, including chromosomal abnormalities, genetic anomalies, autoimmune disorders, endocrine dysfunction, anatomical abnormalities, infectious agents, and idiopathic factors [31]. Particularly, chromosomal abnormalities in embryos are a common cause of RSA. Anomalies in the chromosomal structure or quantity may compromise normal fetal development, leading to a natural miscarriage. In the future, we will conduct embryo chromosome testing and basic etiological screening for all enrolled patients with recurrent miscarriage. For patients with recurrent miscarriage whose etiology is unclear or whose embryos have chromosomal abnormalities, the expression of VEGF, HIF-1α, and MMP2 in the placental villi will be detected, expecting to provide a theoretical basis for the pathogenesis of patients with recurrent miscarriage.
In conclusion, our study demonstrated low VEGF expression in the placental villous tissue of patients with RSA, concurrent with the elevated expression of HIF-1α and MMP2. Although all three elements appear to play crucial roles in the mechanism of RSA development, further investigation is warranted to delineate their specific molecular regulatory mechanisms and pathways.

Notes

Conflict of interest

The authors have no conflicts of interest to declare.

Ethics approval

The present study was approved by the Ethics Committee of The Fourth Hospital of Shijiazhuang (approval ID: 20210002).

Patient consent

Written informed consent was obtained from the patients for the publication of this paper.

Funding information

The Medical Science Research Project of Hebei Province (grant no. 20221677).

Fig. 1
Placental villous tissues of the RSA and control groups were subjected to hematoxylin-eosin staining. Representative images depict the histological features of the tissue. Scale bar: 100 μm (A, C) and 50 μm (B, D). RSA, recurrent spontaneous abortion.
ogs-24176f1.jpg
Fig. 2
Relative mRNA levels of VEGF, HIF-1α, and MMP2 were quantified in placental villous tissue from both RSA patients and the control group. (A) mRNA expressions of VEGF, HIF-1α, and MMP2 were determined in the placental villous tissue using RT qPCR. GAPDH was used as an internal control. (B) mRNA levels were assessed by RT-PCR. VEGF, vascular endothelial growth factor; RSA, recurrent spontaneous abortion; HIF-1α, hypoxia-inducible factor-1α; MMP2, matrix metalloproteinase-2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mRNA, messenger RNA; RT qPCR, real-time quantitative polymerase chain reaction; RT-PCR, real-time polymerase chain reaction. *P<0.05 vs. control group.
ogs-24176f2.jpg
Fig. 3
Analysis of protein levels of VEGF, HIF-1α, and MMP2 in the placental villous tissue between RSA patients and the control group. (A) Western blotting was performed to assess the protein levels of VEGF, HIF-1α, and MMP2 in the placental villous tissue. (B) Quantification of the western blotting results. VEGF, vascular endothelial growth factor; RSA, recurrent spontaneous abortion; HIF-1α, hypoxia-inducible factor-1α; MMP2, matrix metalloproteinase-2. *P<0.05 vs. control group.
ogs-24176f3.jpg
Fig. 4
Correlation analysis of VEGF, HIF-1α, and MMP2 in the placental villous tissue of patients within the RSA group. (A-C) There was no significant correlation between the mRNA expression levels of VEGF, HIF-1α, and MMP2 in the placental villous tissue derived from women with RSA. (D) The protein levels of VEGF were negatively correlated with the MMP2 expression in the placental villi of patients within the RSA group, (F) HIF-1α exhibited a positive correlation with MMP2 expression. (E) Consistent with mRNA analysis results, there was no significant correlation between the protein levels of VEGF and HIF-1α. MMP2, matrix metalloproteinase-2; mRNA, messenger RNA; VEGF, vascular endothelial growth factor; HIF-1α, hypoxia-inducible factor-1α; RSA, recurrent spontaneous abortion.
ogs-24176f4.jpg
Table 1
qRT-PCR primer sequence
Gene Forward primer 5′-3′ Reverse primer 5′-3′
VEGF CCTGGTGGACATCTTCCAGGAGTACC GAAGCTCATCTCTCCTATGTGCTGGC
HIF-1α CATCAGCTATTTGCGTGTGAGGA AGCAATTCATCTGTGCTTTCATGTC
MMP2 ACCTGGATGCCGTCGTGGAC TGTGGCAGCACCAGGGCAGC
GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG

qRT-PCR, quantitative real-time polymerase chain reaction; VEGF, vascular endothelial growth factor; HIF-1α, hypoxia inducible factor-1α; MMP2, matrix metalloproteinase-2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Table 2
Comparison of general data of pregnant women between two groups
Group Number of cases Age (yr) Gestation time (days) BMI (kg/m2)
RSA group 51 29.78±4.02 61.78±3.05 23.26±0.61
Control group 50 28.68±3.13 60.88±2.41 23.41±0.78
t 1.54 1.651 −1.061
P-value 0.127 0.102 0.291

Values are presented as mean±standard deviation or number.

BMI, body mass index; RSA, recurrent spontaneous abortion.

Table 3
The level of VEGF, HIF-1α, and MMP2 mRNA in the placental villus tissue between two groups
Group Number of cases VEGF HIF-1α MMP2
RSA group 51 1.15±0.07 0.96±0.21 2.48±0.33
Control group 50 3.15±0.12 0.36±0.03 1.80±0.27
t −104.607 20.783 11.281
P-value 0.000 0.000 0.000

Values are presented as mean±standard deviation or number.

VEGF, vascular endothelial growth factor; HIF-1α, hypoxia inducible factor-1α; MMP2, matrix metalloproteinase-2; mRNA, messenger RNA; RSA, recurrent spontaneous abortion.

Table 4
The levels of VEGF, HIF-1α, and MMP2 protein in the placental villi tissue between two groups
Group Number of cases VEGF HIF-1α MMP2
RSA group 51 2.22±0.32 1.20±0.28 2.28±0.35
Control group 50 4.01±0.27 0.64±0.37 1.75±0.37
t −30.606 36.413 8.760
P-value 0.000 0.000 0.000

Values are presented as mean±standard deviation or number.

VEGF, vascular endothelial growth factor; HIF-1α, hypoxia inducible factor-1α; MMP2, matrix metalloproteinase-2; RSA, recurrent spontaneous abortion.

Table 5
Correlation analysis of expression of VEGF, HIF-1α, and MMP2
Item VEGF HIF-1α MMP2



r R2 P-value r R2 P-value r R2 P-value
VEGF 1.000 0.000 −0.137 0.337 −0.375 0.141 0.007

HIF-1α −0.137 0.337 1.000 0.000 0.350 0.123 0.012

MMP2 −0.375 0.141 0.007 0.350 0.123 0.012 1.000 0.000

VEGF, vascular endothelial growth factor; HIF-1α, hypoxia inducible factor-1α; MMP2, matrix metalloproteinase-2.

References

1. Deng T, Liao X, Zhu S. Recent advances in treatment of recurrent spontaneous abortion. Obstet Gynecol Surv 2022;77:355-66.
crossref pmid pmc
2. Zargar M, Ghafourian M, Behrahi F, Nikbakht R, Salehi AM. Association of recurrent implantation failure and recurrent pregnancy loss with peripheral blood natural killer cells and interferon-gamma level. Obstet Gynecol Sci 2024;67:112-9.
crossref pmid pmc pdf
3. Colak E, Ozcimen EE, Erinanç OH, Tohma YA, Ceran MU. Is placental KISS-1 expression associated with first trimester abortion spontaneous? Obstet Gynecol Sci 2020;63:490-6.
crossref pmid pmc pdf
4. Trifonova EA, Swarovskaya MG, Ganzha OA, Voronkova OV, Gabidulina TV, Stepanov VA. The interaction effect of angiogenesis and endothelial dysfunction-related gene variants increases the susceptibility of recurrent pregnancy loss. J Assist Reprod Genet 2019;36:717-26.
crossref pmid pmc pdf
5. Kurokawa M, Takeshita A, Hashimoto S, Koyama M, Morimoto Y, Tachibana D. Prevention of intrauterine fetal growth restriction by administrating C1q/TNF-related protein 6, a specific inhibitor of the alternative complement pathway. J Assist Reprod Genet 2022;39:2191-9.
crossref pmid pmc pdf
6. Zhao Y, Sun J, Jin L. The N6-methyladenosine regulator ALKBH5 mediated stromal cell-macrophage interaction via VEGF signaling to promote recurrent spontaneous abortion: a bioinformatic and in vitro study. Int J Mol Sci 2022;23:15819.
crossref pmid pmc
7. Wang X, Hu H, Yu X, Liang C, Han Y, Chen H, et al. Zishen yutai pills promote angiogenesis at the maternal-fetal interface in recurrent spontaneous abortion mice by regulating miR-187/VEGF axis. Drug Des Devel Ther 2024;18:407-23.
crossref pmid pmc pdf
8. Subi TM, Krishnakumar V, Kataru CR, Panigrahi I, Kannan M. Association of VEGF and p53 polymorphisms and spiral artery remodeling in recurrent pregnancy loss: a systematic review and meta-analysis. Thromb Haemost 2022;122:363-76.
crossref pmid
9. Cho GJ, Lee LH, Lee B, Lee J, Ahn KH, Hong SC, et al. Effects of estradiol on HIF-1α expression and trophoblast differentiation in first trimester villous explant cultures. Obstet Gynecol Sci 2018;61:71-8.
crossref pmid pmc pdf
10. Lai Y, Fu Z, Gao Y, Ma N, Li L. Hypoxia-inducible factors (HIFs) in early pregnancy: implications for miscarriage. Biol Reprod 2024;111:987-99.
crossref pmid pdf
11. Park HS, Ko KH, Kim JO, An HJ, Kim YR, Kim JH, et al. Association study between the polymorphisms of matrix metalloproteinase (MMP) genes and idiopathic recurrent pregnancy loss. Genes (Basel) 2019;10:347.
crossref pmid pmc
12. Ma Q, Beal JR, Bhurke A, Kannan A, Yu J, Taylor RN, et al. Extracellular vesicles secreted by human uterine stromal cells regulate decidualization, angiogenesis, and trophoblast differentiation. Proc Natl Acad Sci U S A 2022;119:e2200252119.
crossref pmid pmc
13. Ozden Tokalioglu E, Turgut E, Gulen Yildiz E, Ozturk Agaoglu M, Biriken D, Tanacan A, et al. Comparison of VEGF-A levels in women with threatened abortion, early pregnancy loss and uncomplicated healthy pregnancies. Cytokine 2023;170:156343.
crossref pmid
14. Amin I, Pandith AA, Manzoor U, Mir SH, Afroze D, Koul AM, et al. Implications of VEGF gene sequence variations and its expression in recurrent pregnancy loss. Reprod Biomed Online 2021;43:1035-44.
crossref pmid
15. He X, Chen Q. Reduced expressions of connexin 43 and VEGF in the first-trimester tissues from women with recurrent pregnancy loss. Reprod Biol Endocrinol 2016;14:46.
crossref pmid pmc
16. Pang LH, Li MJ, Li MQ, Yang DM, Shi L. Vascular endothelial growth factor (VEGF) and the VEGF soluble receptor-1 (sFlt-1) in chorionic villus tissue from Chinese women with early recurrent spontaneous abortion. J Int Med Res 2011;39:830-7.
crossref pmid pdf
17. Pang L, Wei Z, Li O, Huang R, Qin J, Chen H, et al. An increase in vascular endothelial growth factor (VEGF) and VEGF soluble receptor-1 (sFlt-1) are associated with early recurrent spontaneous abortion. PLoS One 2013;8:e75759.
crossref pmid pmc
18. Xu Q, Yao Q, Huang S, Xu L, Guan H. Effect of fas/fasL signaling pathway activation in trophoblasts on recurrent spontaneous abortion. J Obstet Gynaecol Res 2021;47:1978-86.
pmid
19. Giannarelli C, Alique M, Rodriguez DT, Yang DK, Jeong D, Calcagno C, et al. Alternatively spliced tissue factor promotes plaque angiogenesis through the activation of hypoxia-inducible factor-1α and vascular endothelial growth factor signaling. Circulation 2014;130:1274-86.
crossref pmid pmc
20. Kashyap N, Das CR, Datta R, Begum A, Islam M, Bose S, et al. Unravelling the oxygen factor - an investigation of transcriptional activation of hypoxia associated placental angiogenesis in recurrent pregnancy loss (RPL) patients from Assam, India. Placenta 2024;154:66-73.
crossref pmid
21. Chen X, Jiang L, Wang CC, Huang J, Li TC. Hypoxia inducible factor and microvessels in peri-implantation endometrium of women with recurrent miscarriage. Fertil Steril 2016;105:1496-502.
crossref pmid
22. Liu T, Yan M, Liu F, Ma Y, Fang Y. The role of p53-MDM2 signaling in missed abortion and possible pathogenesis. J Obstet Gynaecol Res 2022;48:2686-96.
pmid
23. Wu A, Yu R, Li D, Tuo Y. Expression and mechanism of micro-ribonucleic acid-29a in chorionic villi obtained at curettage with recurrent abortion. Gynecol Endocrinol 2022;38:944-8.
crossref pmid
24. Jing M, Chen X, Qiu H, He W, Zhou Y, Li D, et al. Insights into the immunomodulatory regulation of matrix metalloproteinase at the maternal-fetal interface during early pregnancy and pregnancy-related diseases. Front Immunol 2023;13:1067661.
crossref pmid pmc
25. Hamutoğlu R, Bulut HE, Kaloğlu C, Önder O, Dağdeviren T, Aydemir MN, et al. The regulation of trophoblast invasion and decidual reaction by matrix metalloproteinase-2, metalloproteinase-7, and metalloproteinase-9 expressions in the rat endometrium. Reprod Med Biol 2020;19:385-97.
crossref pmid pmc pdf
26. Barišić A, Dević Pavlić S, Ostojić S, Pereza N. Matrix metalloproteinase and tissue inhibitors of metalloproteinases gene polymorphisms in disorders that influence fertility and pregnancy complications: a systematic review and meta-analysis. Gene 2018;647:48-60.
crossref pmid
27. Rahat B, Sharma R, Bagga R, Hamid A, Kaur J. Imbalance between matrix metalloproteinases and their tissue inhibitors in preeclampsia and gestational trophoblastic diseases. Reproduction 2016;152:11-22.
crossref pmid
28. Nissi R, Talvensaari-Mattila A, Kotila V, Niinimäki M, Järvelä I, Turpeenniemi-Hujanen T. Circulating matrix metalloproteinase MMP-9 and MMP-2/TIMP-2 complex are associated with spontaneous early pregnancy failure. Reprod Biol Endocrinol 2013;11:2.
crossref pmid pmc
29. Yan Y, Fang L, Li Y, Yu Y, Li Y, Cheng JC, et al. Association of MMP2 and MMP9 gene polymorphisms with the recurrent spontaneous abortion: a meta-analysis. Gene 2021;767:145173.
crossref pmid
30. Li L, Liu J, Qin S, Li R. The association of polymorphisms in promoter region of MMP2 and MMP9 with recurrent spontaneous abortion risk in Chinese population. Medicine (Baltimore) 2018;97:e12561.
crossref pmid pmc
31. Guan D, Sun W, Gao M, Chen Z, Ma X. Immunologic insights in recurrent spontaneous abortion: molecular mechanisms and therapeutic interventions. Biomed Pharmacother 2024;177:117082.
crossref pmid
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •     Scopus
  • 3,302 View
  • 56 Download
Related articles in Obstet Gynecol Sci

Translocation in patients with recurrent spontaneous abortion.1992 April;35(4)

Chromosomal analysis of abortus chorionic villi in case of recurrent spontaneous abortions.1993 December;36(12)

Cytogenetic study in couples with recurrent spontaneous abortion.1993 December;36(12)



ABOUT
ARTICLE & TOPICS
Article category

Browse all articles >

Topics

Browse all articles >

BROWSE ARTICLES
POLICY
FOR CONTRIBUTORS
Editorial Office
4th Floor, 36 Gangnam-daero 132-gil, Gangnam-gu, Seoul 06044, Korea.
Tel: +82-2-2266-7238    Fax: +82-2-3445-2440    E-mail: journal@ogscience.org                

Copyright © 2026 by Korean Society of Obstetrics and Gynecology.

Developed in M2PI

Close layer
prev next